Figure 1. Description
of the study subjects by age.
Cervical
co-infection with high-risk Human Papillomavirus and Herpes simplex
Saadalnour Abusail
Mustafa1, Alfatih Mohamed Ahmed Alnajib2,
Eldaw Breima Suliman
Mohamed3,4, Ahmed Amin Mohammed5, Hussain Gadelkarim Ahmed6,7
1Department of Clinical Laboratory Science, Faculty of Applied
Medical Science, Najran University, Najran, Saudi Arabia.
2College of Medicine, University of Ha’il,
Saudi Arabia.
3Department of Microbiology, Faculty of Medical Laboratory
Science, University of Kordofan, El-Obeid, Sudan.
4Shikan College of Medicine, El-Obeid, Sudan.
5Department of Obstetrics and Gynecology, Faculty of Medicine,
University of Kordofan, El-Obeid, Sudan.
6Prof Medical Research consultancy Center, El-Obeid, Sudan.
7Department of Histopathology and Cytology, FMLS, University of
Khartoum, Sudan.
Abstract
Background: Herpes Simplex
Virus (HSV) is a common sexually transmitted virus that infects millions of
individuals worldwide. The current study sought to determine the prevalence of
Herpes simplex and Human Papillomavirus (HPV) coinfection in Saudi women. Methodology:
From May 2020 to May 2021, 300 women's cervical smears were collected and sent
to a cytopathology laboratory. Because of gynecologic concerns, the women in
the study were referred for Pap smears. Cervical materials were then evaluated
for the presence of HSV using Polymerase Chain Reaction (PCR) molecular
techniques. Results: HSV was detected in 2% of patients (66.7% HSV-1 and
33.3% HSV-2). HSV-1 and HPV co-infection was found in 50% of patients,
including HPV subtypes 16 and 52. HSV-2 and HPV infection, including HPV
subtype 16, was found in 50% of the cases. Conclusion: The prevalence of
HSV is minimal among Saudi women seeking gynecologic care. Coinfections of HSV
and HPV, particularly HPV subtype 16, are prevalent.
Keywords: Herpes simplex virus, Human Papillomavirus, Saudi Arabia,
cytology, cervical smear
Correspondence to: Dr. Saadelnour AM,
Email: sadosail@yahool.com
Cite this article: Ammar AB, Eltalib
KME, Agab MAAA, Ahmed HG. Medical Research
Updates 2023;1(1): 10-22.
Introduction
Herpes simplex virus (HSV) is among the most
prevalent sexually transmitted viruses. Infection treatment is not therapeutic,
although it can alleviate symptoms and improve quality of life [1]. HSV type 1
or HSV type 2 usually causes genital infection, which can be primary or
recurrent. On a regular basis, the virus replicates in epithelial cells and
produces latency in sensory neurons before reactivating as a local lesion [2].
HSV is transferred through direct touch,
resulting in chronic recurring and painful clinical symptoms. Symptoms include
genital infection, cold sores, encephalitis, keratitis, meningitis, and blepharitis.
Cervical cancer and a variety of sexually transmitted diseases can be
exacerbated by visible illness [3].
The most common sexually transmitted infection
in the world is human papillomavirus (HPV). More than 99% of cervical cancer
cases are caused by high-risk HPV subtypes [4]. HSV and HPV coinfection has
been reported in gynecologic and colposcopy medical procedures. HSV and
high-risk HPV infections have been linked to a history of sexual behavior [5].
HSV type 2 and high-risk HPV coinfection were found to enhance the risk of
invasive cervical cancer [6]. In this study, we looked at Herpes simplex and
Human Papillomavirus coinfection in Saudi women.
About 300 women were referred to the
cytopathology laboratory of the maternity hospital in Al-Madinah, Saudi Arabia,
between May 2020 and May 2021. The women in the research were referred for Pap
smears due to gynecologic issues. A Pap smear is requested as part of the
mandatory investigations in combination with the clinical assessment. Prior to
sample collection, each patient was asked to sign a documented ethical consent
form.
Cytological samples were obtained by scraping
the ectocervix's transition zone. The components were evenly dispersed on a
clean glass slide and were promptly fixed in 95% ethyl alcohol while still wet.
Following fixation, the smears were stained using the Papanicolaou method (Pap.
Method), as follows: the dehydrated smears were soaked in decreasing ethyl
alcohol concentrations (90%, 70%, 50%, and finally DW), for two minutes at a
time. After five minutes, the smears were stained with Harris' hematoxylin
(nuclear stain), rinsed in DW, differentiated in 0.5% aqueous hydrochloric acid
for ten seconds (to eliminate remaining stain atoms), and immediately rinsed in
DW to end decolorization. The smears were then blued for five seconds in
alkaline water before being dehydrated in ethyl alcohol concentrations of 50%,
70%, 90%, and 95% for two minutes each. The smears were then stained for two
minutes with Pap. OrangeG6 (cytoplasmic stain), rinsed in 95% ethyl alcohol,
and dyed in EA50 (cytoplasmic stain) for three minutes. The smears were then
treated with 95% and 100% ethyl alcohol, cleaned in Xylene, and mounted in Distrene Polystyrene Xylene (DPX).
Cervical materials were further tested for the
presence of HSV and HPV using molecular methods, such as polymerase chain
reaction (PCR), as described by Scoular et al. [7] (See Table 1&2).
DNA extraction
Proteinase K degrades proteins as well as
potentially hazardous enzymes such as nucleases. A buffer containing the
denaturing agent sodium dodecyl sulfate (SDS) was added to facilitate
digestion. Nucleic acids were isolated from tissue lysate using high-speed
centrifugation and buffer-saturated phenol. After that, RNase A was added to
the phenol extractions to remove any tainted RNA. Following RNase an
incubation, further phenol extractions were performed to remove any remaining
enzyme. After adding sodium acetate and isopropanol to precipitate the DNA,
high-speed centrifugation was used to pellet the DNA and make it easier to
extract the isopropanol. After washing the DNA with 70% ethanol to remove
excess salts, it was centrifuged to re-pellet it. DNA is quantified,
resuspended in distilled water, and stored at 20 °C. Later, purified DNA was
utilized in downstream applications of PCR.
DNA quantification
To assess DNA quantity after DNA extraction,
we used a Nano-Drop spectrophotometer to analyze DNA.
Amplification of HPV
Type-specific primers (primer for HPV 31, HPV
33, HPV 35, HPV 39, and HPV 45) were used to detect HPV31, 33, 35, 39, and 45
DNA in cervical lesions using the American Joint Committee on Cancer (AJCC) TNM
classification and the International Federation of Gynecology and Obstetrics
(FIGO) staging system. The HPV31, 33, 35, 39, and 45 amplification kit from Sacace-Biotechnologies S.r.l.
Caserta, Italy was utilized. The total volume of the final reaction was 40 l,
which included 10 l of mix-2, 20 l of mix-1 (contained in PCR tubes), and 20 l
of extracted DNA (sample). Negative control, positive HPV31,33,35,39, and 45
DNA tubes received 10 l of DNA buffer and 10 l of HPV31,33,35,39, and 45.
Gene Amp PCR system 9700 was used to amp up samples and controls.
Gel-electrophoresis
The PCR products were realized in a 2% Agarose
gel with 0.5 g/ml Ethidium bromide. Ten microliters of PCR product and a 100 bp DNA ladder were placed onto the gel. Gel electrophoresis
was performed at 120 V and 36 mA for 60 minutes. The photographs were taken
with a Gel documentation system (Gel mega, digital camera and computer
software).
Table 1. HSV genotype
|
HSV Genotype |
Sequence
(5'–3') |
Amplification (bp) |
|
HSV-1 |
CAGACAGCAAAAATCCCCTGAG
ACGAGGGAAAACAATAAGG |
196 |
|
HSV-2 |
CACCGTCGCCCTATACAGCTT ATCGACGGGATGTGCCAGTTT |
210 |
Table 2 PCR steps. Cycle's
time temp PCR steps
|
Cycles |
Time |
Temperature |
Steps |
|
|||
|
Pause |
94°C |
0 |
||||
|
1 |
5 min |
94°C |
1 |
|
|||
|
25 |
30
sec |
94°C |
2 |
|
|||
|
30
sec |
48°C |
|
|||||
|
25 sec |
72°C |
|
|||||
|
1 |
1
min |
72°C |
3 |
|
|||
|
Storage |
4°C |
4 |
||||
Data were first
organized in an Excel spreadsheet before being moved to SPSS software for
analysis to obtain frequencies, percentages, means, cross-tabulations, and the
chi-square test. P-values of 0.05 are deemed statistically significant when the
95% confidence interval is used.
Ethical Consent
Before the interview, participants were
requested to sign a written ethical consent form. The proposal for the current
study was authorized by the Ethical Committee at the College of Medicine,
University Ha'il, Saudi Arabia. 00130/CM-UOH.04/20
HREC.
Three hundred
samples from women were examined for the presence of HPV and HSV. The women's
ages ranged from 20 to 70. As shown in Fig 1, the majority of women were
between the ages of 31 and 40, with 41-50, 51-60, 20-30, and >60 years
constituting 27.7%, 26.7%, 24.3%, 10.7%, and 10.7%, respectively.
Figure 1. Description
of the study subjects by age.
HSV was discovered positive in 6/300 (2%) of
the patients in this series (4/6(66.7%) HSV-1 and 2/6(33.3%) HSV-2). HSV-1 and
HPV co-infection was found in 2/4 (50%) of the patients, which comprised HPV
subtypes 16 and 52. HSV-2 and HPV coinfection was found in 12 (50%) of the
cases, including HPV subtype 16, as shown in Table 1 and Figure 2.
Table 1. Correlation between HSV and HPV
|
Variable |
|
Herpes Simples |
|
Total |
||
|
|
HSV-1 |
|
Total |
|
HSV-2 |
|
|
|
Positive |
Negative |
|
Positive |
Negative |
|
|
HPV |
|
|
|
|
|
|
|
Positive |
2 |
12 |
14 |
1 |
13 |
14 |
|
Negative |
2 |
284 |
286 |
1 |
285 |
286 |
|
Total |
4 |
296 |
300 |
2 |
298 |
300 |
|
HPV-Subtypes |
|
|
|
|
|
|
|
HPV-16 |
1 |
5 |
6 |
1 |
5 |
6 |
|
HPV-18 |
0 |
1 |
1 |
0 |
1 |
1 |
|
HPV-52 |
1 |
2 |
3 |
0 |
3 |
3 |
|
HPV-58 |
0 |
2 |
2 |
0 |
2 |
2 |
|
HPV-33 |
0 |
2 |
2 |
0 |
2 |
2 |
|
Total |
2 |
12 |
14 |
1 |
13 |
14 |
Figure 2. HSV and
HPV co-infection
Atypical cytological alterations were found in
4/6 (67%) of HSV-positive individuals, including 2/4 (50%) of HSV-1 cases and
2/2 (100%) of HSV-2 cases. In two cases, inflammatory cell infiltrates were
observed: one (25%) HSV-1 and one (50%) HSV-2. As shown in Table 2 Fig 3, all
Candida Albian’s cases tested negative for HSV.
Table 2. Distribution of HSV by cervical cytopathology
|
Variable |
|
Herpes simples |
|
Total |
||
|
|
HSV-1 |
Total |
HSV-2 |
|
||
|
|
Positive |
Negative |
|
Positive |
Negative |
|
|
Cytological
atypia |
|
|
|
|
|
|
|
Normal |
2 |
265 |
267 |
1 |
266 |
267 |
|
Mild atypia |
0 |
10 |
10 |
1 |
10 |
11 |
|
Moderate |
0 |
11 |
11 |
0 |
10 |
10 |
|
Severe |
2 |
10 |
12 |
0 |
12 |
12 |
|
Total |
4 |
296 |
300 |
2 |
298 |
300 |
|
Inflammatory
change |
|
|
|
|
|
|
|
Yes |
1 |
70 |
71 |
1 |
70 |
71 |
|
No |
3 |
226 |
229 |
1 |
228 |
229 |
|
Total |
4 |
296 |
300 |
2 |
298 |
300 |
|
Candida Albicans |
|
|
|
|
|
|
|
Yes |
0 |
7 |
7 |
0 |
7 |
7 |
|
No |
4 |
289 |
293 |
2 |
291 |
293 |
|
Total |
4 |
296 |
300 |
2 |
298 |
300 |
Figure 3. HSV by
cervical cytopathology
As shown in Table
3, approximately 2/4 (50%) of the HSV-1 positive cases were seen in the age
group >60 years, one (25%) in the age group 51-60 years, and one (25%) in
the age group 41-50 years, whereas one (50%) case HSV-2 was seen in the age
group 20-30 years and the remaining one in the age group 41-50 years.
Table 3. HSV
infection status by age
|
Variable |
|
Herpes simples |
|
Total |
||
|
|
HSV-1 |
Total |
HSV-2 |
|
||
|
|
Positive |
Negative |
|
Positive |
Negative |
|
|
20-30 years |
0 |
32 |
32 |
1 |
31 |
32 |
|
31-40 |
0 |
83 |
83 |
0 |
83 |
83 |
|
41-50 |
1 |
79 |
80 |
1 |
79 |
80 |
|
51-60 |
1 |
72 |
73 |
0 |
73 |
73 |
|
>60 |
2 |
30 |
32 |
0 |
32 |
32 |
|
Total |
4 |
296 |
300 |
2 |
298 |
300 |
Figure 4. PCR
amplification of HSV-1 and HSV-2 in cervical samples.
The products were
separated on a 2% agarose gel and stained with an ethidium bromide 1000bp
ladder (arrows show 100 and 200 bands), with HSV-1 positive in 196 bp. HSV-2 is not present.
In this Saudi
patient series, the overall HSV prevalence was 2% (with roughly 67% HSV type 1
and approximately 33% HSV type 2). Saudi Arabian epidemiological data on HSV
are limited. A Saudi Arabian study assessed IgG and IgM antibodies in women and
neonates in a group of patients with recurrent abortion. The presence of IgM in
1.3% of women indicated a recent HSV type 1 infection. The presence of IgG,
observed in around 81% of the women, indicated past HSV exposure.
As a result, HSV
infection is associated with infertility [8]. Another Saudi Arabian study
included 4985 women who were screened for HSV. The total prevalence of HSV type
1 was 88.8%, while HSV type 2 was 1.26%, according to the study. The incidence
was substantially higher among those who were married, divorced, or widowed.
Other sexually transmitted diseases, such as Treponema pallidum and the Human
Immunodeficiency Virus (HIV), have been found to be more common [9]. However,
491.5 persons were predicted to be infected with HSV type 2, accounting for 13.2%
of the world's population aged 15-49. Furthermore, 3752 million people were
found to be infected with HSV type 1, for a global prevalence of 66.6%.
Infection patterns varied according to geographical area, sex, and age [10].
In the current
study, almost half of the cases of HSV infection had HPV coinfection. Some
investigations have assumed HSV and HPV virus co-infection, as well as other
carcinogenic viruses [11,12]. Furthermore, some researchers believe that HVS
infection may encourage subsequent HPV infection [13]. Coinfection occurred
with a variety of HPV subtypes, with a higher prevalence of HPV subtype 16.
The current study
found that HSV type 1 was linked to severe cytological atypia, whereas HSV type
2 was linked to mild cytological atypia. However, HSV replication in human
epithelial cells causes structural alterations in the cell cytoplasmic
organelles and nucleus, which eventually result in visible morphological
abnormalities [14]. Infection with HSV type 1 disrupts the end of transcription
of RNA polymerase II in host genes [15].
In the current
investigation, inflammatory cells were found in two cases, one (25%) HSV-1 and
one (50%) HSV-2.
HSV can activate
both innate and adaptive immune responses in host cells, triggering a cascade
of events that results in the release of inflammatory mediators that recruit a
large number of inflammatory cells [16].
In the current
study, HSV infections were more common in older adults (> 50 years old); the
incidence of HSV by age varies according to a variety of factors, including
geographical region, community sexual behavior, and population subgroups.
Females are more likely than males to be infected with HSV type 2 [17].
The current
analysis revealed some hidden HSV data in Saudi Arabia, but it has significant
limitations, including a lack of previous immune globulins, which predicts
previous exposure.
In conclusion: The frequency of
HSV is low among Saudi women seeking gynecologic care. Coinfections of HSV and
HPV, particularly HPV subtype 16, are prevalent.
The authors would
like to thank Dr. Hashim M. Missawi
at the Department of clinical pathology, maternity, and children's hospital,
for his help in sample collection and consultation.
SAM: Conceptual,
consultation, funding, and approval of the final version
AMAA: Conceptual,
data analysis, funding, and approval of the final version
EBSM: conceptual,
manuscript drafting, and approval of the final version
AAM: conceptual,
administration, funding, and approval of the final version
HGA: conceptual,
administration, funding, and approval of the final version
Self-funded.
The
participants of this study did not give written consent for their data to be
shared publicly, so due to the sensitive nature of the research supporting data
is not available.
No
interest to declare
1- Cole
S. Herpes Simplex Virus: Epidemiology, Diagnosis, and Treatment. Nurs Clin North Am. 2020
Sep;55(3):337-345. doi:
10.1016/j.cnur.2020.05.004.
2- Mathew
Jr J, Sapra A. Herpes Simplex Type 2. 2021 Feb 23.
In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2021 Jan–. PMID: 32119314.
3- Caputo
A, Marconi P. Vaccine Development for Herpes Simplex Viruses: A Commentary of
Special Issue Editors. Vaccines (Basel). 2021 Feb 16;9(2):158. doi: 10.3390/vaccines9020158. PMID: 33669413; PMCID:
PMC7920455.
4- Yuan
Y, Cai X, Shen F, Ma F. HPV post-infection microenvironment and cervical
cancer. Cancer Lett. 2021 Jan 28; 497:243-254. doi:
10.1016/j.canlet.2020.10.034.
5- Bahena-Román M, Sánchez-Alemán MA,
Contreras-Ochoa CO, Lagunas-Martínez A, Olamendi-Portugal
M, López-Estrada G, Delgado-Romero K, Guzmán-Olea E, Madrid-Marina V, Torres-Poveda K. Prevalence of active infection by herpes simplex
virus type 2 in patients with high-risk human papillomavirus infection: A
cross-sectional study. J Med Virol. 2020
Aug;92(8):1246-1252. doi: 10.1002/jmv.25668.
6- Smith
JS, Herrero R, Bosetti C, Muñoz N, Bosch FX, Eluf-Neto J, Castellsagué X,
Meijer CJ, Van den Brule AJ, Franceschi S, Ashley R;
International Agency for Research on Cancer (IARC) Multicentric Cervical Cancer
Study Group. Herpes simplex virus-2 as a human papillomavirus cofactor in the
etiology of invasive cervical cancer. J Natl Cancer Inst. 2002 Nov
6;94(21):1604-13. doi: 10.1093/jnci/94.21.1604.
7- Scoular
A, Gillespie G, Carman WF. Polymerase chain reaction for diagnosis of genital
herpes in a genitourinary medicine clinic. Sex Transm
Infect. 2002 Feb;78(1):21-5. doi:
10.1136/sti.78.1.21.
8- Althaqafi RMM, Elrewiny M, Abdel-Moneim AS. Maternal and neonatal infections of herpes
simplex virus-1 and cytomegalovirus in Saudi Arabia. J Infect Public Health.
2020 Feb;13(2):313-314. doi:
10.1016/j.jiph.2019.11.020.
9- Memish ZA, Almasri M, Chentoufi
AA, Al-Tawfiq JA, Al-Shangiti
AM, Al-Kabbani KM, Otaibi
B, Assirri A, Yezli S.
Seroprevalence of Herpes Simplex Virus Type 1 and Type 2 and Coinfection with
HIV and Syphilis: The First National Seroprevalence Survey in Saudi Arabia. Sex
Transm Dis. 2015 Sep;42(9):526-32. doi: 10.1097/OLQ.0000000000000336. PMID: 26267880.
10- James
C, Harfouche M, Welton NJ, Turner KM, Abu-Raddad LJ, Gottlieb SL, Looker KJ. Herpes simplex virus:
global infection prevalence and incidence estimates, 2016. Bull World Health
Organ. 2020 May 1;98(5):315-329. doi: 10.2471/BLT.19.237149.
11- Guidry
JT, Scott RS. The interaction between human papillomavirus and other
viruses. Virus Res. 2017; 231:139-147. doi:
10.1016/j.virusres.2016.11.002.
12- Akbari
M, Elmi R. Herpes Simplex Virus and Human
Papillomavirus Coinfections in Hyperimmunoglobulin E Syndrome Presenting as a
Conjunctival Mass Lesion. Case Rep Med. 2017; 2017:1650841. doi:
10.1155/2017/1650841. Epub 2017 Oct 12. PMID:
29158737; PMCID: PMC5660752.
13- Mäki J, Paavilainen H, Kero K, Hukkanen V, Syrjänen S. Herpes simplex and human papilloma virus
coinfections in oral mucosa of men-A 6-year follow-up study. J Med Virol. 2018 Mar;90(3):564-570. doi:
10.1002/jmv.24965.
14- Ahmad
I, Wilson DW. HSV-1 Cytoplasmic Envelopment and Egress. Int
J Mol Sci. 2020 Aug 19;21(17):5969. doi: 10.3390/ijms21175969.
15- Wang
X, Hennig T, Whisnant AW, Erhard F, Prusty BK, Friedel CC, Forouzmand
E, Hu W, Erber L, Chen Y, Sandri-Goldin RM, Dölken L, Shi Y. Herpes simplex virus blocks host
transcription termination via the bimodal activities of ICP27. Nat Commun. 2020 Jan 15;11(1):293. doi:
10.1038/s41467-019-14109-x.
16- Wang
L, Wang R, Xu C, Zhou H. Pathogenesis of Herpes Stromal Keratitis: Immune
Inflammatory Response Mediated by Inflammatory Regulators. Front Immunol. 2020
May 13; 11:766. doi: 10.3389/fimmu.2020.00766.
17- Smith
JS, Robinson NJ. Age-specific prevalence of infection with herpes simplex virus
types 2 and 1: a global review. J Infect Dis. 2002 Oct 15;186 Suppl 1: S3-28. doi:
10.1086/343739.